Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders

Fahimeh Beigi; Masoud Reza Manaviat; Nasrin Ghasemi

doi:doi:10.11648/j.ijmri.20260201.13

Research Article |

| Peer-Reviewed

Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders

Fahimeh Beigi

, Masoud Reza Manaviat, Nasrin Ghasemi^*

Published in International Journal of Medical Research and Innovation (Volume 2, Issue 1)

Received: 15 October 2025 Accepted: 8 December 2025 Published: 29 December 2025

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

Background: Leber congenital amaurosis (LCA) is one of the most common inherited retinal disorders characterized by rod-cone dystrophy nystagmus, strabismus, with decreased vision after birth, photophobia, cataracts and keratoconus. In the study, we found different genotypes in patients with two different non-syndromic and syndromic patterns in an Iranian family with autosomal recessive retinitis pigmentosa (arRP). Materials and methods: The proband’s variant were detected by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel of 234 genes related to Inherited retinal dystrophies. The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants, following that it performed cosegregation data in the family. The variants were confirmed by Sanger sequencing using specific primers. Results: Molecular study of NGS and following sanger sequencing showed two variants in different CRB1 and AHI1 genes in the patients of family. In the study in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene. Patients affected to LCA and a patient affected to Joubert syndrome (JBTS) presented different clinical features. Conclusions: In the present study. NGS is considered as the most new and powerful sequencing technique to detect causal variants in different genes. In the family identified two different molecular genetic characteristics of patients with (LCA) and mild JBTS which is involved retinal degeneration which are known to cause severe inherited retinal dystrophies.

Published in	International Journal of Medical Research and Innovation (Volume 2, Issue 1)
DOI	10.11648/j.ijmri.20260201.13
Page(s)	17-22
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2025. Published by Science Publishing Group

Keywords

Leber Congenital Amaurosis (LCA), Autosomal Recessive Retinitis Pigmentosa (arRP), Next Generation Sequencing (NGS), CRB1, AHI1, Joubert Syndrome (JS)

1. Introduction

Retinitis pigmentosa (RP) is the most common heterogenous genetic group of hereditary retinal degenerations. The Prevalence of RP is approximatively 1 in 3000 to 4000 or 1.5 million individuals in the worldwide

[1-3]

. RP is a clinical and genetic heterogeneous disease with several inheritance patterns

[4-6]

They are as autosomal dominant (adRP) (30–40%), autosomal recessive (arRP) (50–60%) and X-linked (XLRP) traits (5–15%). In addition, the existence of complex and mitochondrial forms has been previously reported. RP can manifest as syndromic disease in more than 30% or non-syndromic form in 70-80% of cases

[7]

. Up to now, more than 80 genes (https://sph.uth.edu/retnet/) have been involved as syndromic or non-syndromic forms of RP

[8]

Leber congenital amaurosis (LCA; OMIM 204000) is one of the most common retinal disorders that is as the most severe form of retinitis pigmentosa (RP)

[9, 10]

. Clinical symptoms of LCA include nystagmus, strabismus, with decreased vision from the early in life, photophobia, cataracts and keratoconus. In addition, the most cases of LCA may have a good level of intelligence

[11, 12]

. The prevalence of LCA is estimated to be 1 case per 30.000-80.000 individuals and about 5% of inherited retinal disorders (IRD)

[10, 12]

. Although, LCA can rarely be inherited in autosomal dominant form for instance owing to mutations in IMPDH1, CRX or OTX2 gene, it is usually transferred in autosomal recessive inheritance pattern. So far, mutations in 25 genes have been described to cause pathogenesis of LCA including AIPL1, CABP4, CCT2, CEP290, CLUAP1, CRB1, CRX, DTHD1, GDF6, GUCY2D, IFT140 IMPDH1, IQCB1, KCNJ13, LCA5, LRAT, NMVAT1, OTX2, PRPH2, RD3, RDH12, RPE65, RPGRIP1 SPATA7, TULP1)

[9]

. These genes encode proteins responsible for various retinal functions such as intra- photoreceptor ciliary transport, photoreceptor morphogenesis, phototransduction, vitamin A cycling and others. Among of them, three proteins of CRB1, CRX and GDF6 play a key role in photoreceptor morphogenesis

[13]

. The expression of CRB1 as a human homolog protein is in the brain and the inner segments photoreceptors. Mutations in the Crumbs homolog 1 (CRB1, MIN #604210) gene could cause early- onset retinal dystrophies (EORD) with various clinical manifestations as Leber congenital amaurosis (LCA) (MIN #613835), early-onset RP (MIN #600105) and cone-rod degeneration

[11, 14]

. In addition, Mutations in CRB1 gene may lead to progression gradually for several decades. Until now, more than 150 different mutations of CRB1 gene have been reported that they are mostly located in the extracellular region

[15]

For the first time, AHI1 gene was reported by different studies in related to Joubert syndrome (JBTS; MIM #213300). However, mutations in 34 genes have been reported to be associated JBTS, AHI1 is one of the most common pathogenic gene accounting for 38% JBTS population. Indeed, mutations in two AHI1 and CEP290 genes have been related to retinal degeneration

[16]

. The Jouberin protein encoded by AHI1 gene acts as a scaffold and lead to promote the formation and function of primary cilia

[17]

. It characterized by dysplasia of cerebellar vermis part, neurological dysfunction, retinal dystrophy, developmental delay and breathing abnormalities

[18-20]

. Furthermore, the recent findings revealed that AHI1 gene as mild JBTS phenotypes are involved in non-syndromic retinal disorders with mild neurological symptoms or without neurological symptoms

[19]

In this study, the disease- causing mutations in two different genes of an Iranian family with 6 affected members were identified by Next Generation Sequencing (NGS) using a panel of 4.900 genes related with known clinical diseases. Thereby, these finding cause to provide essential information for further genetic counseling and gene therapy.

2. Material and Methods

This study was approved by the Ethics Committee of Shahid Saduoghi University of Yazd Medical Sciences (IR.SSU.MEDICINE.REC.1395.91). The consent form, full medical and family history were taken from this large Iranian family. This study carried out based on Declaration Helsinki.

Extraction of the genomic DNA was obtained from all members peripheral blood in the family by using automated DNA extractor BIORObot EZ1 (Qiagen, Hilden, Germany). Measurement of the DNA purity was performed by UV spectrophotometer.

Molecular study was performed in the proband of the family by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel (Illumina, San Diego, CA, USA) in Genetics Department of Fundacion Jimenez Diaz University Hospital Madrid, Spain. TSO library was provided using the manufacturer’s instructions and sequenced on the Nextseq500 platform (Illumina). The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants including M-CAP

[21]

, CADD

[22]

and those included in the commercial Alamut software v2.9.0 (Interactive Biosoftware, Rouen, France),, following that it performed cosegregation data in the family. Variants of CRB1 and AHI1 were confirmed by Sanger sequencing using specific primers (F-CRB1-Primer: GCGATGGCTTCCTGTGGG and R-CRB1-Primer: GGTCGCTACCTCTCACCGT) and the variant of AHI1 was confirmed by Sanger sequencing using specific primers (F-AHI1-Primer: CTTGGTTTACCATTGGTCGTT and R-AHI1-Primer: GCGCAATCAGTACATAACC).

3. Case Presentations

The pedigree chart of the family diagnosed with retinitis pigmentosa and an autosomal recessive genetic pattern is drawn (Figure 1). The proband (VI:2) was a 12-year-old male who presented the clinical phenotype relate to RP disease including nystagmus, night blindness, photophobia in infancy. His older affected brother (VI:1) was 19-year-old and also presented similar age of onset of symptoms and phenotypic features. Ophthalmology examination showed the affected patients had night blindness and impairment of visual acuity (VA) in the early life and gradually developed decline in vision. The fundus photography of the proband’s left eye revealed the pigmentary retinal dystrophy with changes of bone spicule in retina area and tortuous veins. Optical coherence topography (OCT) revealed loss of lamination and irregular layer. In the proband’s fluorescein angiography showed increasing of macula avascular zone with changes of hypofluorescent and hyperfluorescent spots due to RPE cells injury. Their unaffected parents have consanguineous marriage. Proband’s mother (V:2), his maternal affected aunt (V:1) and his two maternal healthy uncles were born from his consanguineous healthy maternal grandfather (IV:5) and grandmother (IV:1). Proband’s maternal affected aunt (V:1) was a 35-year-old who clinical symptoms included early visual impairment, severer nystagmus in two eyes, refraction defects and photophobia. Proband, his affected brother and his affected aunt were diagnosed with RP after birth. Her clinical signs were progressed at 16 years old. Cataract surgery was performed on her right eye at 30 years old. Her right eye A-vector & B-mode sonography revealed that there is mild lobulation of the globe wall. The posterior two-thirds of the globe wall is hyperechoic and shows posterior acoustic shadowing could be due to dense calcification or ossification. The thickness of the crystalline lens is within normal range. The cortex of the lens is echogenic suggestive of mature cataract, most likely to be calcified and slightly subluxated posteriorly. Coronal membrane is seen in anterior third of the posterior segment could be cyclitic membrane or portion of RD.

Proband’s maternal cousin (V:5) was a 36 years old affected female who had unaffected parents. She was only patient with clinical phenotype relate to syndromic disease in this family. She presented nystagmus, developmental delay with hypotonia, mild neurological symptoms, poor language skills, walking imbalance mildly, night blindness, loss of peripheral vision at childhood and no respiratory difficulties. Ophthalmology examination exhibited retina pigmentation, thinning of retinal vessels. Other affected patients in the family were diagnosed with RP non-syndromic disease. In addition, there were affected brother (VI:4) a 23-year-old male and sister (VI:3) a 29-year-old female at this family who have distant relatives with the proband. Their unaffected parents had consanguineous marriage. Clinical symptoms of them were similar to proband’s signs. but, the affected brother (VI:4) presented keratoconus and the affected sister (VI:3) had nystagmus and also strabismus at 28 years old that it removed without wearing the glasses.

Download: Download full-size image

Figure 1. Pedigree of Family with Leber Congenital Amaurosis (LCA) & Joubert Syndrome and Segregation Results of Two Variants c.1576C>T (p. Arg 526*) in CRB1 Gene and c.2105C>T (p. Thr702Met) in AHI1 Gene.

The molecular study by NGS in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene (NM_017651.4; c. 2105C>T; p. (Thr702Met)).

Segregation analysis of the variant c.1576C>T in the CRB1 gene performed in the family has confirmed that proband’s healthy parents and all patients’ unaffected parents in the family are heterozygous. Besides, proband’s affected maternal aunt (V:1), two affected individuals of distant relatives (VI:3 & VI:4) are homozygous mutation. Whereas, proband’s maternal cousin (V:5) had a normal CRB1 sequence without any mutation and has confirmed the homozygous mutation in AHI1 gene. The variant was described first time by Suzuki et al. The in-silico prediction tools used classified the variants in CRB1 and AHI1 genes as pathogenic and probably pathogenic, respectively (Table 1).

Table 1. The Variants Found in the CRB1 and AHI1 Genes with in Silico Prediction.

Gene Variant Polyphen Mutation Taster CADD M-CAP SIFT
CRB1 c.1576C>T; p. (Arg526*) N/A Disease causing (1.0) Mildly deleterious (35) N/A N/A
AHI1 c. 2105C>T; p. (Thr702 Met) Probably damaging Disease causing (1.0) Mildly deleterious (32) Possible pathogenic Damaging (0.899) (0.047) (0.009)

4. Discussion

In present study, we report two variants in genes CRB1 (c.1576C>T; (p. Arg 526*)) and AHI1 (c.2105C>T; (p. Thr702Met)) disease- causing two Leber congenital amaurosis (LCA) and Joubert syndrome (JBTS), in an Iranian family with consanguineous marriage. A meta-analysis study of mutations of CRB1 described these mutations as a common disease-causing of childhood-onset retinal disorders which account for over 10.1% of LCA/EORD affected individuals and 2.7% in RP patients

[11]

. Indeed, over than 194 mutations in CRB1 associated with the pathogenesis of RP with autosomal recessive inheritance pattern in diverse populations that 189 of them are located in extracellular domain

[23-25]

. The variant (c.1576C>T; (p. Arg 526*)) in CRB1 gene was previously reported

[9]

. This change has been described in the general population with a low allele frequency (rs114342808; 0.000032; dbSNP & Exome Aggregation Consortium -ExAc-). Mutations in the CRB1 gene have been associated with autosomal recessive forms of cone-rod dystrophies, Leber congenital amaurosis and retinitis pigmentosa, mainly (Human Gene Mutation Database-HGMD)

[11]

. However, early-onset RP is as a milder form than LCA, their diagnosis in some patients due to high clinical overlap is difficult

[14]

The Genotype/phenotype correlation due to the existence of diverse CRB1 associated to retinal phenotypes and different types of mutations such as missense, null mutations (i.e.; frameshift and nonsense) and splice-site in the several studies is unknown

[24]

. In several previous studies revealed that severe retinal phenotypes instance in LCA might be related to null mutations. Moreover, it would be suggested that the existence of the modifying factors on CRB1 mutations might affect the patients’ retinal phenotypes

[26]

The incidence of JBTS is estimated between 1:80,000 and 1:100,000

[27-29]

. There are six subgroups of JBTS based on the organ involvement

[30]

. Mutations in AHI1 are the most common disease- causing type of JBTS with ocular disorders

[29]

. In the study, the patient (V:5)’s clinical features include defect in primary cilia function, night blindness vision, nystagmus, poor visual acuity, walking imbalance, developmental delay and mild neurological symptoms. Moreover, the mean of age death at patients affected to JBTS is 7.2 years

[30]

, while the age of present case is 36 years old. The findings confirmed as mild JBTS with retinal degeneration. The result has previously been reported in the Chinese patient carrying variant at c.2105C>T (p. Thr702Met) in AHI1 gene

[30]

. In the present patient, we identified the missense variant at c. 2105C>T (p. T702M) in AHI1 gene which is considered a probably pathogenic variant. T702M variant is located in WD40 domain of Jouberin. The AHI1 gene encodes Jouberin protein which includes a coiled-coil domain in N-terminal, WD40 domain and C-terminal SH3 binding domain

[30]

. Valente et al, 2006 has been described rare missense mutations in exons and introns of AHI1 gene might modify Jouberin protein truncation and lead to loss of function and most null mutations (nonsense and frameshift mutations) lead to alter structure in the protein

[26]

. Although, Nguyen et al, 2017 reported missense mutations in the WD40 domain could lead to non-syndromic RP with mild manifestations and late-onset

[31]

. Suzuki et al, 2016 reported the variant p. 702M in AHI1 gene in a compound heterozygous pattern with the AHI1 gene c.903_910insA p.304fs*309 insertion. The clinical symptoms reported as JBTS without ocular defects

[32]

, whereas, other study has showed a pathogenic pattern of AHI1 gene p. E281* with clinical manifestations including retinal degeneration and pure JBTS in the patients.

The findings revealed that there are any correlations between clinical features of patients and the type variant of AHI1 gene. Besides, the effect of T720M on Jouberin protein conformation and its function is ambiguous

[30]

In conclusion, we found two different variants in two CRB1 and AHI1 genes causing LCA disease and mild JBTS with retinal defects with diversity clinical manifestations in an Iranian family. CRB1 mutations is one of the most common causes of LCA and early-onset RP in the Iranian populations.

Abbreviations

LCA	Leber Congenital Amaurosis
ArRP	Autosomal Recessive retinitis Pigmentosa
NGS	Next Generation Sequencing
CRB1	Crumbs Cell Polarity Complex Component
AHI1	Abelson Helper Integration Site 1
JBTS	Joubert Syndrome

Acknowledgments

Thanks to Cristina Villaverde and Olga Zurita for their technical support. This work was supported by grants from the Instituto de Salud Carlos III (ISCIII) of the Spanish Ministry of Health, including the Center for Biomedical Research Network on Rare Diseases (CIBERER 06/07/0036), FIS (PI16/00425), and from Regional Government of Madrid (CAM, B2017/BMD37), all partially supported by FEDER (European Regional Development Fund). In addition, the University Chair UAM-IIS-FJD of Genomic Medicine and Ramon Areces Foundation also supported our work. MDPV was supported by a Ph.D. fellowship from the Conchita R´abago Foundation and IPR by a Ph.D. fellowship from the predoctoral Program from Instituto de Salud Carlos III (ISCIII; FI17/00192).

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1]	Haim, M. Epidemiology of retinitis pigmentosa in Denmark. Acta Ophthalmologica Scandinavica. Supplement, 2002, 233, 1–34. https://doi.org/10.1046/j.1395-3907.2002.00001.x
[2]	Hamel, C. Retinitis pigmentosa. Orphanet Journal of Rare Diseases, 2006, 1(1), 40. https://doi.org/10.1186/1750-1172-1-40
[3]	Chang, S., Vaccarella, L., Olatunji, S., Cebulla, C., & Christoforidis, J. Diagnostic challenges in retinitis pigmentosa: genotypic multiplicity and phenotypic variability. Current Genomics, 2011, 12(4), 267–275. https://doi.org/10.2174/138920211795860116
[4]	Bird, A. C. Retinal photoreceptor dystrophies LI. Edward Jackson Memorial Lecture. American Journal of Ophthalmology, 1995, 119(5), 543–562. https://doi.org/10.1016/s0002-9394(14)70212-0
[5]	Daiger, S P, Sullivan, L. S., & Bowne, S. J. Genes and mutations causing retinitis pigmentosa. Clinical Genetics, 2013, 84(2), 132–141. https://doi.org/10.1111/cge.12203
[6]	Hartong, D. T., Berson, E. L., & Dryja, T. P. Retinitis pigmentosa. The Lancet, 2016. 368(9549), 1795–1809. https://doi.org/10.1016/S0140-6736(06)69740-7
[7]	Liu Y, Zong X, Cao W, Zhang W, Zhang N, and Yang N. Gene therapy for retinitis pigmentosa: current challenges and new progress. Biomolecules, 2024, 14, 903. https://doi.org/10.3390/biom14080903
[8]	Guo, X., Li, J., Wang, Q., Shu, Y., Wang, J., Chen, L., et al. Identification of CRB1 mutations in two Chinese consanguineous families exhibiting autosomal recessive retinitis pigmentosa. Molecular Medicine Reports, 2019, 20(3), 2922–2928. https://doi.org/10.3892/mmr.2019.10495
[9]	Chacon-Camacho, O, F., Zenteno J, C. Review and update on the molecular basis of Leber congenital amaurosis. World Journal Clinical Cases, 2015, 3(2), 112-124. https://doi.org/10.12998/wjcc.v3.i2.112
[10]	Skorczyk-Werner, A., Niedziela, Z., Stopa, M., & Krawczyński, M. R. Novel gene variants in Polish patients with Leber congenital amaurosis (LCA). Orphanet Journal of Rare Diseases, 2020, 15(1), 345. https://doi.org/10.1186/s13023-020-01634-y
[11]	Corton, M., Tatu, S. D., Avila-Fernandez, A., Vallespín, E., Tapias, I., Cantalapiedra, D., et al. High frequency of CRB1 mutations as cause of Early-Onset Retinal Dystrophies in the Spanish population. Orphanet Journal of Rare Diseases, 2013, 8, 20. https://doi.org/10.1186/1750-1172-8-20
[12]	Xu, K., Xie, Y., Sun, T., Zhang, X., Chen, C., & Li, Y. Genetic and clinical findings in a Chinese cohort with Leber congenital amaurosis and early onset severe retinal dystrophy. The British Journal of Ophthalmology, 2020, 104(7), 932–937, https://doi.org/10.1136/bjophthalmol-2019-314281
[13]	Kumaran, N., Moore, A. T., Weleber, R. G., & Michaelides, M. Leber congenital amaurosis/early-onset severe retinal dystrophy: clinical features, molecular genetics and therapeutic interventions. The British Journal of Ophthalmology, 2017, 101(9), 1147–1154. https://doi.org/10.1136/bjophthalmol-2016-309975
[14]	Li, S., Shen, T., Xiao, X., Guo, X., & Zhang, Q. Detection of CRB1 mutations in families with retinal dystrophy through phenotype-oriented mutational screening. International Journal of Molecular Medicine, 2014, 33(4), 913–918. https://doi.org/10.3892/ijmm.2014.1655
[15]	Bujakowska, K., Audo, I., Mohand-Saïd, S., Lancelot, M.-E., Antonio, A., Germain, A., et al. CRB1 mutations in inherited retinal dystrophies. Human Mutation, 2012, 33(2), 306–315. https://doi.org/10.1002/humu.21653
[16]	Wang, S. F., Kowal, T. J., Ning, K., Koo, E. B., Wu, A. Y., Mahajan, V. B., & Sun, Y. Review of Ocular Manifestations of Joubert Syndrome. Genes, 2018, 9(12). https://doi.org/10.3390/genes9120605
[17]	Jasim R, A., Abed A, Y., Khalaf AL-Fahdawi M, H., Al-Zaalan A, R., Hamid R, T., Shihab R, N., Mostafa Neissi M., et al. Joubert Syndrome and the AHI1 p. Gln981Glu Variant: A Molecular and Clinical Study, Sinapse, 2025, 25(2), https://doi.org/10.46531/sinapse/CC/141/202
[18]	Joubert, M., Eisenring, J. J., & Andermann, F. Familial dysgenesis of the vermis: a syndrome of hyperventilation, abnormal eye movements and retardation. Neurology, 1968, 18(3), 302–303.
[19]	Romani, M., Micalizzi, A., & Valente, E. M. Joubert syndrome: congenital cerebellar ataxia with the molar tooth. The Lancet. Neurology, 2013, 12(9), 894–905. https://doi.org/10.1016/S1474-4422(13)70136-4
[20]	Chafai-Elalaoui, S., Chalon, M., Elkhartoufi, N., Kriouele, Y., Mansouri, M., Attié-Bitach, T., et al. homozygous AHI1 gene mutation (p. Thr304AsnfsX6) in a consanguineous Moroccan family with Joubert syndrome: a case report. Journal of Medical Case Reports, 2015, 9, 254. https://doi.org/10.1186/s13256-015-0732-3
[21]	Gudkov M., Thibaut L., Monger S., Das D., Winlaw D, S., Dunwoodie S, L., Giannoulatou E. Benchmarking of variant pathogenicity prediction methods using a population genetics approach. Bioinformatics Advances, 2025, 5(1). https://doi.org/10.1093/bioadv/vbaf227
[22]	Rentzsch P., Witten D., Cooper G, M., Shendure J., Kircher M, CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic Acids Research, 2019,47(D1), D886–D894. https://doi.org/10.1093/nar/gky1016
[23]	Cordovez, J. A., Traboulsi, E. I., Capasso, J. E., Sadagopan, K. A., Ganesh, A., Rychwalski, P. J., et al. Retinal Dystrophy with Intraretinal Cystoid Spaces Associated with Mutations in the Crumbs Homologue (CRB1) Gene. Ophthalmic Genetics, 2015, 36(3), 257–264. https://doi.org/10.3109/13816810.2014.881505
[24]	Beryozkin, A., Zelinger, L., Bandah-Rozenfeld, D., Harel, A., Strom, T. A., Merin, S., et al. Mutations in CRB1 are a relatively common cause of autosomal recessive early-onset retinal degeneration in the Israeli and Palestinian populations. Investigative Ophthalmology & Visual Science, 2013, 54(3), 2068–2075. https://doi.org/10.1167/iovs.12-11419
[25]	Chen, Y., Lin, Y., Vithana, E. N., Jia, L., Zuo, X., Wong, T. Y., et al. Common variants near ABCA1 and in PMM2 are associated with primary open-angle glaucoma. Nature Genetics, 2014, 46(10), 1115–1119. https://doi.org/10.1038/ng.3078
[26]	Valente, E. M., Brancati, F., Silhavy, J. L., Castori, M., Marsh, S. E., Barrano, G., et al. AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders. Annals of Neurology, 2006, 59(3), 527–534. https://doi.org/10.1002/ana.20749
[27]	Brancati, F., Dallapiccola, B., & Valente, E. M. Joubert Syndrome and related disorders. Orphanet Journal of Rare Diseases, 2010, 5(1), 20. https://doi.org/10.1186/1750-1172-5-20
[28]	Parisi, M. A., Doherty, D., Eckert, M. L., Shaw, D. W., Ozyurek, H., Aysun, S., et al. AHI1 mutations cause both retinal dystrophy and renal cystic disease in Joubert syndrome. Journal of Medical Genetics, 2006, 43(4), 334–339. https://doi.org/10.1136/jmg.2005.036608
[29]	Kroes, H. Y., van Zon, P. H. A., Fransen van de Putte, D., Nelen, M. R., Nievelstein, R.-J., Wittebol-Post, D., et al. DNA analysis of AHI1, NPHP1 and CYCLIN D1 in Joubert syndrome patients from the Netherlands. European Journal of Medical Genetics, 2008, 51(1), 24–34. https://doi.org/10.1016/j.ejmg.2007.10.001
[30]	Chen, C., Gao, J., Lv, Q., Xu, C., Xia, Y., & Du, A. Retinitis pigmentosa and molar tooth sign caused by novel AHI1 compound heterozygote pathogenic variants. BMC Medical Genomics, 2021, 14(1), 242. https://doi.org/10.1186/s12920-021-01089-5
[31]	Nguyen, T.-M. T., Hull, S., Roepman, R., van den Born, L. I., Oud, M. M., de Vrieze, E., Hetterschijt, L., et al. Missense mutations in the WD40 domain of AHI1 cause non-syndromic retinitis pigmentosa. Journal of Medical Genetics, 2017, 54(9), 624–632. https://doi.org/10.1136/jmedgenet-2016-104200
[32]	Suzuki, T., Miyake, N., Tsurusaki, Y., Okamoto, N., Alkindy, A., Inaba, A., et al. Molecular genetic analysis of 30 families with Joubert syndrome. Clinical Genetics, 2016, 90(6), 526–535. https://doi.org/10.1111/cge.12836

Cite This Article

Plain Text BibTeX RIS

APA Style

Beigi, F., Manaviat, M. R., Ghasemi, N. (2025). Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. International Journal of Medical Research and Innovation, 2(1), 17-22. https://doi.org/10.11648/j.ijmri.20260201.13

Copy | Download

ACS Style

Beigi, F.; Manaviat, M. R.; Ghasemi, N. Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. Int. J. Med. Res. Innovation 2025, 2(1), 17-22. doi: 10.11648/j.ijmri.20260201.13

Copy | Download

AMA Style

Beigi F, Manaviat MR, Ghasemi N. Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. Int J Med Res Innovation. 2025;2(1):17-22. doi: 10.11648/j.ijmri.20260201.13

Copy | Download

@article{10.11648/j.ijmri.20260201.13,
  author = {Fahimeh Beigi and Masoud Reza Manaviat and Nasrin Ghasemi},
  title = {Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders},
  journal = {International Journal of Medical Research and Innovation},
  volume = {2},
  number = {1},
  pages = {17-22},
  doi = {10.11648/j.ijmri.20260201.13},
  url = {https://doi.org/10.11648/j.ijmri.20260201.13},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ijmri.20260201.13},
  abstract = {Background: Leber congenital amaurosis (LCA) is one of the most common inherited retinal disorders characterized by rod-cone dystrophy nystagmus, strabismus, with decreased vision after birth, photophobia, cataracts and keratoconus. In the study, we found different genotypes in patients with two different non-syndromic and syndromic patterns in an Iranian family with autosomal recessive retinitis pigmentosa (arRP). Materials and methods: The proband’s variant were detected by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel of 234 genes related to Inherited retinal dystrophies. The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants, following that it performed cosegregation data in the family. The variants were confirmed by Sanger sequencing using specific primers. Results: Molecular study of NGS and following sanger sequencing showed two variants in different CRB1 and AHI1 genes in the patients of family. In the study in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene. Patients affected to LCA and a patient affected to Joubert syndrome (JBTS) presented different clinical features. Conclusions: In the present study. NGS is considered as the most new and powerful sequencing technique to detect causal variants in different genes. In the family identified two different molecular genetic characteristics of patients with (LCA) and mild JBTS which is involved retinal degeneration which are known to cause severe inherited retinal dystrophies.},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders
AU  - Fahimeh Beigi
AU  - Masoud Reza Manaviat
AU  - Nasrin Ghasemi
Y1  - 2025/12/29
PY  - 2025
N1  - https://doi.org/10.11648/j.ijmri.20260201.13
DO  - 10.11648/j.ijmri.20260201.13
T2  - International Journal of Medical Research and Innovation
JF  - International Journal of Medical Research and Innovation
JO  - International Journal of Medical Research and Innovation
SP  - 17
EP  - 22
PB  - Science Publishing Group
SN  - 3070-6319
UR  - https://doi.org/10.11648/j.ijmri.20260201.13
AB  - Background: Leber congenital amaurosis (LCA) is one of the most common inherited retinal disorders characterized by rod-cone dystrophy nystagmus, strabismus, with decreased vision after birth, photophobia, cataracts and keratoconus. In the study, we found different genotypes in patients with two different non-syndromic and syndromic patterns in an Iranian family with autosomal recessive retinitis pigmentosa (arRP). Materials and methods: The proband’s variant were detected by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel of 234 genes related to Inherited retinal dystrophies. The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants, following that it performed cosegregation data in the family. The variants were confirmed by Sanger sequencing using specific primers. Results: Molecular study of NGS and following sanger sequencing showed two variants in different CRB1 and AHI1 genes in the patients of family. In the study in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene. Patients affected to LCA and a patient affected to Joubert syndrome (JBTS) presented different clinical features. Conclusions: In the present study. NGS is considered as the most new and powerful sequencing technique to detect causal variants in different genes. In the family identified two different molecular genetic characteristics of patients with (LCA) and mild JBTS which is involved retinal degeneration which are known to cause severe inherited retinal dystrophies.
VL  - 2
IS  - 1
ER  -

Copy | Download

Author Information

Fahimeh Beigi

Department of Medical Genetics, Shahid Sadoughi University of Medical Sciences, Yazd, Iran;Department of Pharmacy and Pharmaceutical Sciences, Isfahan University of Medical Science, Isfahan, Iran

Contact Email

http://orcid.org/0000-0001-7666-4290
Masoud Reza Manaviat

Department of Ophthalmology, Shahid Sadoughi University of Medical Science, Yazd, Iran
Nasrin Ghasemi

Abortion Research and Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, Iran

Contact Email

Download PDF

Submit an Article

Figure 1

Figure 1. Pedigree of Family with Leber Congenital Amaurosis (LCA) & Joubert Syndrome and Segregation Results of Two Variants c.1576C>T (p. Arg 526*) in CRB1 Gene and c.2105C>T (p. Thr702Met) in AHI1 Gene.

Table 1

Table 1. The Variants Found in the CRB1 and AHI1 Genes with in Silico Prediction.

Plain Text BibTeX RIS

APA Style

Beigi, F., Manaviat, M. R., Ghasemi, N. (2025). Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. International Journal of Medical Research and Innovation, 2(1), 17-22. https://doi.org/10.11648/j.ijmri.20260201.13

Copy | Download

ACS Style

Beigi, F.; Manaviat, M. R.; Ghasemi, N. Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. Int. J. Med. Res. Innovation 2025, 2(1), 17-22. doi: 10.11648/j.ijmri.20260201.13

Copy | Download

AMA Style

Beigi F, Manaviat MR, Ghasemi N. Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders. Int J Med Res Innovation. 2025;2(1):17-22. doi: 10.11648/j.ijmri.20260201.13

Copy | Download

@article{10.11648/j.ijmri.20260201.13,
  author = {Fahimeh Beigi and Masoud Reza Manaviat and Nasrin Ghasemi},
  title = {Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders},
  journal = {International Journal of Medical Research and Innovation},
  volume = {2},
  number = {1},
  pages = {17-22},
  doi = {10.11648/j.ijmri.20260201.13},
  url = {https://doi.org/10.11648/j.ijmri.20260201.13},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ijmri.20260201.13},
  abstract = {Background: Leber congenital amaurosis (LCA) is one of the most common inherited retinal disorders characterized by rod-cone dystrophy nystagmus, strabismus, with decreased vision after birth, photophobia, cataracts and keratoconus. In the study, we found different genotypes in patients with two different non-syndromic and syndromic patterns in an Iranian family with autosomal recessive retinitis pigmentosa (arRP). Materials and methods: The proband’s variant were detected by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel of 234 genes related to Inherited retinal dystrophies. The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants, following that it performed cosegregation data in the family. The variants were confirmed by Sanger sequencing using specific primers. Results: Molecular study of NGS and following sanger sequencing showed two variants in different CRB1 and AHI1 genes in the patients of family. In the study in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene. Patients affected to LCA and a patient affected to Joubert syndrome (JBTS) presented different clinical features. Conclusions: In the present study. NGS is considered as the most new and powerful sequencing technique to detect causal variants in different genes. In the family identified two different molecular genetic characteristics of patients with (LCA) and mild JBTS which is involved retinal degeneration which are known to cause severe inherited retinal dystrophies.},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Identification of Two CRB1 and AHI1 Pathogenetic Variants in an Iranian Family with Two Syndromic and Non-Syndromic Inherited Retinal Disorders
AU  - Fahimeh Beigi
AU  - Masoud Reza Manaviat
AU  - Nasrin Ghasemi
Y1  - 2025/12/29
PY  - 2025
N1  - https://doi.org/10.11648/j.ijmri.20260201.13
DO  - 10.11648/j.ijmri.20260201.13
T2  - International Journal of Medical Research and Innovation
JF  - International Journal of Medical Research and Innovation
JO  - International Journal of Medical Research and Innovation
SP  - 17
EP  - 22
PB  - Science Publishing Group
SN  - 3070-6319
UR  - https://doi.org/10.11648/j.ijmri.20260201.13
AB  - Background: Leber congenital amaurosis (LCA) is one of the most common inherited retinal disorders characterized by rod-cone dystrophy nystagmus, strabismus, with decreased vision after birth, photophobia, cataracts and keratoconus. In the study, we found different genotypes in patients with two different non-syndromic and syndromic patterns in an Iranian family with autosomal recessive retinitis pigmentosa (arRP). Materials and methods: The proband’s variant were detected by Next Generation Sequencing (NGS) using True Sight One Clinical Exome (TSO) panel of 234 genes related to Inherited retinal dystrophies. The pathogenicity of the variants was determined based on their allele frequency in the Genome aggregation database (gnomAD), In silico prediction tools for new missense and splicing variants, following that it performed cosegregation data in the family. The variants were confirmed by Sanger sequencing using specific primers. Results: Molecular study of NGS and following sanger sequencing showed two variants in different CRB1 and AHI1 genes in the patients of family. In the study in proband (VI:2) revealed a homozygous frameshift variant in the exon 6 of the CRB1 gene (NM_201253.2; c.1576C>T; p. (Arg526*)) and in other member of the family a homozygous missense variant in the exon 15 of the AHI1 gene. Patients affected to LCA and a patient affected to Joubert syndrome (JBTS) presented different clinical features. Conclusions: In the present study. NGS is considered as the most new and powerful sequencing technique to detect causal variants in different genes. In the family identified two different molecular genetic characteristics of patients with (LCA) and mild JBTS which is involved retinal degeneration which are known to cause severe inherited retinal dystrophies.
VL  - 2
IS  - 1
ER  -

Copy | Download